My friend Arvind Gupta has written an awesome book with Po Bronson about how the new genetic era combined with the advances in computing is going to bring so much more clarity and understanding to our biology and how that can change the world. I was eagerly awaiting the launch of the book on October 6th and have been reading it. I could not wait to finish the book to write about it. So far it has been a fascinating read. If you are interested to learn about people solving hard problems in biology and building breakout companies, you need to start reading this book.
The first chapter is about COVID and a group of founders on how they are starting to tackle this challenge. I am excited and intrigued at the speed of ideas and what can be done to take this pandemic by its horn and wrestle with it. Leaving all politics out I can only imagine the focused effort, money and people who have been impacted by this pandemic starting to really go to war with this virus. Make no mistake, this global challenge is not going away soon and we need to fight it and solve it. I like how Arvind and Po start the book, the genetic sequence on the cover of the book reads out CTCTGTTAGCGTCTGCTCGTCAGCCTGTGAAGCCTGCTCCTAGTACTGTAGACTCATATCCTA, for those of you wondering what is this gibbrish? you can use a simplified DNA writer (I bet you did not know this existed before you reading this, if you did then you are much ahead in the understanding of the human attempt at understanding our DNA) to find out. It says
Nothing is inevitable
Here is an excerpt from the book that shows what can be done with out-of-the-box thinking
Melanie had made antibodies against Zika when she was at IndieBio. She believed she could do it again against this virus. There are 23 companies trying to invent the perfect antibody, and a dozen more trying to design one with a super computer. “They’re slow,”, Melanie said. “They start in humanized mice, then hope what they get works in humans. It takes tons of repetition and adjustment. In a computer, you can design an antibody in days. But you have no idea if it will have off target effects, so that testing takes months and months.” Melanie said she could do it in 32 days.
Melanie’s approach was truly unique. Her company, Prellis, was the world leader in 3D-printing human organ tissue, using lasers and stem cells. Her goal for Prellis was right out of a science fiction movie: She wants to print a new liver for patients when their liver is shot. She was getting close. She’d been making mini-livers.
But this was wartime. “I can make dozens of mini lymph nodes, little immune systems. I’ll inoculate them with the virus. They’ll create antibodies just like they would inside a human body. I’ll screen the antibodies for which works best.”
Chapter 1 – First Coronavirus Death in U.S. and New Cases Detected as Testing Expands – Washington Post
I am reading the book as fast as I can… actually not, I am reading it slowly as I want to absorb everything in it. I highly recommend that you get the book, you will never see biology and human ingenuity the same way ever again.
Discover more from Startup Iceland
Subscribe to get the latest posts sent to your email.


